WormMine: Gene WBGene00056097

• WormBase Gene ID: WBGene00056097
• Gene Name: Cre-ima-2
• Sequence Name: CRE28547
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable nuclear import signal receptor activity. Predicted to be involved in protein import into nucleus. Predicted to be located in cytoplasm. Is an ortholog of C. elegans ima-2. In C. elegans, ima-2 is involved in several processes, including meiotic sister chromatid cohesion; mitotic nuclear membrane reassembly; and protein import into nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28547.1	CRE28547.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28547	CRE28547		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104544
• Remark: Cre-ima-2, GGAGTCTCAGTCGGAACAGATCTATTCTCAAGCCTATCGCATTATAACTCAATTCTTCTC, WBGene00056097
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region