WormMine: Gene WBGene00056313

• WormBase Gene ID: WBGene00056313
• Gene Name: Cre-haf-9
• Sequence Name: CRE28438
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and transmembrane transporter activity. Predicted to be involved in peptide transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans haf-9. In C. elegans, haf-9 is involved in lysosomal transport and regulatory ncRNA-mediated post-transcriptional gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28438.1	CRE28438.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28438	CRE28438		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101854
• Remark: Cre-haf-9, AAACAAAGAATCGCAATTGCCCGTGCTCTTGTCCGTCAACCAGTTGTTCTTCTTTTAGAT, WBGene00056313
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region