WormMine: Gene WBGene00056328

• WormBase Gene ID: WBGene00056328
• Gene Name: Cre-smg-2
• Sequence Name: CRE28432
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity; RNA helicase activity; and small molecule binding activity. Predicted to be involved in nuclear-transcribed mRNA catabolic process, nonsense-mediated decay. Predicted to be located in cytoplasm. Is an ortholog of C. elegans smg-2. In C. elegans, smg-2 is involved in embryonic genitalia morphogenesis and negative regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE28432.1	CRE28432.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE28432	CRE28432		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100438
• Remark: Cre-smg-2, CGCTTGAACGTTGCTATCACTCGTGCTAAATATGGTATTGTTGTTGTTGGTAATGCGAAA, WBGene00056328
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region