WormMine: Gene WBGene00056723

• WormBase Gene ID: WBGene00056723
• Gene Name: Cre-pygl-1
• Sequence Name: CRE08793
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable glycogen phosphorylase activity and pyridoxal phosphate binding activity. Predicted to be involved in carbohydrate metabolic process. Is an ortholog of C. elegans pygl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE08793.1	CRE08793.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE08793	CRE08793		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113625
• Remark: CRE08793, GAAACATGAAGTTCATGTTGAACGGAGCACTTACTATCGGAACTCTTGATGGAGCCAATG, WBGene00056723
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region