WormMine: Gene WBGene00057283

• WormBase Gene ID: WBGene00057283
• Gene Name: Cre-acdh-8
• Sequence Name: CRE11824
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable flavin adenine dinucleotide binding activity and oxidoreductase activity, acting on the CH-CH group of donors. Is an ortholog of C. elegans acdh-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11824.1	CRE11824.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11824	CRE11824		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1108398
• Remark: CRE11824, GAACTTCTCAAATTCAACGAATGGTTATTGCTCGTACTCTTCTTTCCCATTTCACTCATA, WBGene00057283
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region