WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00057326 Gene Name  Cre-cdc-14
Sequence Name  ? CRE11964 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Dual specificity phosphatase, catalytic domain; Protein-tyrosine phosphatase-like; Dual specificity protein phosphatase, N-terminal half; Dual specificity protein phosphatase domain; Dual specificity/tyrosine protein phosphatase, N-terminal; and Tyrosine-protein phosphatase CDC14. Is an ortholog of C. elegans cdc-14. In C. elegans, cdc-14 is involved in several processes, including cytoskeleton-dependent cytokinesis; mitotic spindle midzone assembly; and regulation of cell cycle process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE11964.1 CRE11964.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE11964 CRE11964   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-cdc-14, CTCTCATTGTCGATGAAACATCACTAGATGAGCAAGGAAGATCTCAAGGAGATCGACTTC, WBGene00057326   Expr1105482 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region