WormMine: Gene WBGene00058303

• WormBase Gene ID: WBGene00058303
• Gene Name: Cre-gcy-9
• Sequence Name: CRE07496
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Predicted to be located in membrane. Is an ortholog of C. elegans gcy-9. In C. elegans, gcy-9 is involved in several processes, including cellular response to acidic pH; detection of chemical stimulus; and positive regulation of neuronal action potential.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07496.1	CRE07496.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07496	CRE07496		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116894
• Remark: Cre-gcy-9, GTGCAACTGTGTTGTTCTCAGATATTAGAGGGTTCACTCGCATTTCTTCAACTTCAACTC, WBGene00058303
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region