WormMine: Gene WBGene00058387

• WormBase Gene ID: WBGene00058387
• Gene Name: Cre-dgn-1
• Sequence Name: CRE07443
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be located in membrane. Predicted to be part of dystrophin-associated glycoprotein complex. Is an ortholog of C. elegans dgn-1. In C. elegans, dgn-1 is involved in anatomical structure morphogenesis; inductive cell migration; and positive regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07443.1	CRE07443.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07443	CRE07443		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093940
• Remark: Cre-dgn-1, GAAAAACGGAAAGAAGAAGTCTACCAGCACCGAATACGTCTCCAAGGGACTCCCCGTTGT, WBGene00058387
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region