WormMine: Gene WBGene00058433

• WormBase Gene ID: WBGene00058433
• Gene Name: Cre-abl-1
• Sequence Name: CRE07410
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and non-membrane spanning protein tyrosine kinase activity. Is an ortholog of C. elegans abl-1. In C. elegans, abl-1 is involved in several processes, including defense response to other organism; negative regulation of DNA damage response, signal transduction by p53 class mediator; and negative regulation of engulfment of apoptotic cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07410.1	CRE07410.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07410	CRE07410		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115495
• Remark: Cre-abl-1, AAACCAGTCGACGGTAAACTGGTTATGGCTTTCCAAGACTGCTTTGATCAAATCATGCGT, WBGene00058433
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region