WormMine: Gene WBGene00058555

• WormBase Gene ID: WBGene00058555
• Gene Name: Cre-unc-3
• Sequence Name: CRE15310
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity and protein dimerization activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans unc-3. In C. elegans, unc-3 is involved in several processes, including dauer larval development; neuron differentiation; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15310.1	CRE15310.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15310	CRE15310		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1094931
• Remark: Cre-unc-3, AAAACTGCTTCCAAAGTATCCAGGAGATCCGGATCGTCTTCCAAAGGATCTCATCCTTAA, WBGene00058555
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region