WormMine: Gene WBGene00058780

• WormBase Gene ID: WBGene00058780
• Gene Name: Cre-ceh-28
• Sequence Name: CRE19252
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans ceh-28. In C. elegans, ceh-28 is involved in positive regulation of transcription by RNA polymerase II and regulation of neuron differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE19252.1	CRE19252.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE19252	CRE19252		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093531
• Remark: Cre-ceh-28, TCTGCGTTTCCGTTTGGTATCAACAGTTTTGGAAGTGTCCCTTCAACTACAGGATCATAA, WBGene00058780
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region