WormMine: Gene WBGene00058819

• WormBase Gene ID: WBGene00058819
• Gene Name: Cre-crt-1
• Sequence Name: CRE31098
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity and unfolded protein binding activity. Predicted to be involved in protein folding. Predicted to be located in endoplasmic reticulum. Is an ortholog of C. elegans crt-1. In C. elegans, crt-1 is involved in several processes, including determination of adult lifespan; hemidesmosome assembly; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31098.1	CRE31098.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31098	CRE31098		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1109148
• Remark: Cre-crt-1, AAAATGGATCCACCCAGAAATCGAGAACCCAGAATACACACCTGATGATGAGCTTTACGC, WBGene00058819
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region