WormMine: Gene WBGene00058968

• WormBase Gene ID: WBGene00058968
• Gene Name: Cre-cni-1
• Sequence Name: CRE30765
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in vesicle-mediated transport. Is an ortholog of C. elegans cni-1. In C. elegans, cni-1 is involved in negative regulation of anterograde synaptic vesicle transport; negative regulation of receptor localization to synapse; and positive regulation of ERAD pathway.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30765.1	CRE30765.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30765	CRE30765		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092558
• Remark: CRE30765, TCAACACTTCGCATCTCCTGGATCAAATTGGCTTTCTACCTTATCTCATTCTTCTATTAC, WBGene00058968
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region