WormMine: Gene WBGene00058974

• WormBase Gene ID: WBGene00058974
• Gene Name: Cre-dhc-3
• Sequence Name: CRE30761
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable dynein intermediate chain binding activity and dynein light intermediate chain binding activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans dhc-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30761.1	CRE30761.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30761	CRE30761		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098190
• Remark: CRE30761, GAATGTGTTACTCTCTTCATCTTTTTGACAGATTTTATAGAATTTCTTTAGCTTCGTTGG, WBGene00058974
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region