WormMine: Gene WBGene00059125

• WormBase Gene ID: WBGene00059125
• Gene Name: Cre-gcy-6.1
• Sequence Name: CRE30672
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable guanylate cyclase activity and protein kinase activity. Predicted to be involved in cGMP biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans gcy-6. In C. elegans, gcy-6 is involved in several processes, including positive regulation of calcium-mediated signaling; response to magnesium ion; and response to salt.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30672.1	CRE30672.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30672	CRE30672		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100323
• Remark: CRE30672, GACTTTAGTATTCCTCATTTGCCGGGAGAGAAGATTAATATTCGAGTTGGATTTCATTGT, WBGene00059125
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region