WormMine: Gene WBGene00059137

• WormBase Gene ID: WBGene00059137
• Gene Name: Cre-cept-2
• Sequence Name: CRE30928
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable phosphotransferase activity, for other substituted phosphate groups. Predicted to be involved in phospholipid biosynthetic process. Predicted to be located in membrane. Is an ortholog of C. elegans cept-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30928.1	CRE30928.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30928	CRE30928		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101582
• Remark: CRE30928, AATCGATTAATTGTCGCACACATGAGTCGGAGTGAACTATCGCTTTGGGATTGGATTTAT, WBGene00059137
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region