WormMine: Gene WBGene00059203

• WormBase Gene ID: WBGene00059203
• Gene Name: Cre-ins-1.2
• Sequence Name: CRE30308
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable hormone activity. Predicted to be located in extracellular region. Is an ortholog of C. elegans ins-1. In C. elegans, ins-1 is involved in several processes, including learning or memory; negative regulation of insulin receptor signaling pathway; and regulation of dauer entry.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30308.1	CRE30308.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30308	CRE30308		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117327
• Remark: CRE11097, TCACCAACAAAAACGAGGAGGAATCGCCACGGAATGCTGTGAGAAACGTTGCTCATTCGC, WBGene00074898
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region