WormMine: Gene WBGene00059224

• WormBase Gene ID: WBGene00059224
• Gene Name: Cre-nfu-1
• Sequence Name: CRE11085
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable iron ion binding activity and iron-sulfur cluster binding activity. Predicted to be involved in iron-sulfur cluster assembly. Is an ortholog of C. elegans nfu-1. In C. elegans, nfu-1 is involved in lipid storage.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11085.1	CRE11085.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11085	CRE11085		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1114260
• Remark: Cre-lpd-8, TGAAGGATGAATCAGATGATTTGGTGGAGAGAGAGTTGAAGAAGTTCGAGCAATCGAGAG, WBGene00059224
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region