WormMine: Gene WBGene00059233

• WormBase Gene ID: WBGene00059233
• Gene Name: Cre-fmo-2
• Sequence Name: CRE10900
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable N,N-dimethylaniline monooxygenase activity; NADP binding activity; and flavin adenine dinucleotide binding activity. Is an ortholog of C. elegans fmo-2. In C. elegans, fmo-2 is involved in defense response to Gram-negative bacterium and one-carbon metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10900.1	CRE10900.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10900	CRE10900		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096706
• Remark: Cre-fmo-2, GCGATGGCTCAGCAATTTGTGAAATCCAGAAGACACACTATTCAAGTTGACTACATCCCG, WBGene00059233
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region