WormMine: Gene WBGene00059372

• WormBase Gene ID: WBGene00059372
• Gene Name: Cre-gcy-8
• Sequence Name: CRE11013
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Expressed in AFDL and AFDR. Is an ortholog of C. elegans gcy-8. In C. elegans, gcy-8 is involved in microvillus organization and response to temperature stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11013.1	CRE11013.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11013	CRE11013		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

• Primary Identifier: Expr12206
• Remark: Expression tested in C elegans

• Primary Identifier: Expr1117571
• Remark: Cre-gcy-8, GTTATGTATGAGATTATATTCAGAGCTCTTCCATTCCCAGAGGGTACTAATCAGTCAGAG, WBGene00059372
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region