WormMine: Gene WBGene00059831

• WormBase Gene ID: WBGene00059831
• Gene Name: CRE29633
• Sequence Name: CRE29633
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to be involved in regulation of ARF protein signal transduction. Is an ortholog of C. elegans Y106G6G.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29633.1	CRE29633.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29633	CRE29633		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104745
• Remark: CRE29633, TCTTTCATCTCCAGATCTTGCAGTCAGACAGTTAGCAGTAGATTTCATGTCTAGATTAGC, WBGene00059831
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region