WormMine: Gene WBGene00059890

• WormBase Gene ID: WBGene00059890
• Gene Name: Cre-ndk-1
• Sequence Name: CRE29604
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable nucleoside diphosphate kinase activity. Predicted to be involved in CTP biosynthetic process; GTP biosynthetic process; and UTP biosynthetic process. Is an ortholog of C. elegans ndk-1. In C. elegans, ndk-1 is involved in several processes, including positive regulation of MAPK cascade; positive regulation of vulval development; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE29604.1	CRE29604.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE29604	CRE29604		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE
	Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

• Primary Identifier: Expr1117299
• Remark: CRE29604, AAGCAAGAGGAGATCAACGACTACGCCAGCCCATTCATCAACTCCTGGGTCTACGAATAA, WBGene00059890
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region