WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060059 Gene Name  Cre-atp-3
Sequence Name  ? CRE29512 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable proton-transporting ATP synthase activity, rotational mechanism. Predicted to be involved in proton motive force-driven ATP synthesis. Is an ortholog of C. elegans atp-3. In C. elegans, atp-3 is involved in determination of adult lifespan and proton motive force-driven mitochondrial ATP synthesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE29512.1 CRE29512.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE29512 CRE29512   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-atp-3, AGCAAGATTGGAAAGTCTGGGCAGAAGCTTACCGTCACTTACGCTGTTAAGCCATCGATT, WBGene00060059   Expr1113168 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region