WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060153 Gene Name  Cre-rme-6
Sequence Name  ? CRE17064 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: VPS9 domain superfamily; Rho GTPase activation protein; GTPase-activator protein for Ras-like GTPase; Ras GTPase-activating domain; VPS9 domain; and Vacuolar sorting protein 9 (VPS9) domain. Is an ortholog of C. elegans rme-6. In C. elegans, rme-6 is involved in endocytosis; molting cycle; and regulation of clathrin-dependent endocytosis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE17064.1 CRE17064.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE17064 CRE17064   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-rme-6, GACGCCTACTACTGGGTCAACTTCAAGTCCGCTGTTGAATATATCAAGACCATATTGTGA, WBGene00060153   Expr1096105 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region