WormMine: Gene WBGene00060226

• WormBase Gene ID: WBGene00060226
• Gene Name: Cre-daf-3
• Sequence Name: CRE17104
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans daf-3. In C. elegans, daf-3 is involved in several processes, including defense response to Gram-negative bacterium; determination of adult lifespan; and positive regulation of dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17104.1	CRE17104.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17104	CRE17104		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101912
• Remark: Cre-daf-3, GTTTGGAAAAGGATTTGGAGATGCATACCCAGAGCGTCCTATCGTATCACAGTGTCCTGT, WBGene00060226
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region