WormMine: Gene WBGene00060371

• WormBase Gene ID: WBGene00060371
• Gene Name: Cre-vha-10
• Sequence Name: CRE03636
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable proton-transporting ATPase activity, rotational mechanism. Predicted to be involved in proton transmembrane transport. Predicted to be part of vacuolar proton-transporting V-type ATPase complex. Is an ortholog of C. elegans vha-10. In C. elegans, vha-10 is involved in positive regulation of programmed cell death and programmed cell death.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03636.1	CRE03636.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03636	CRE03636		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1094165
• Remark: Cre-vha-10, TGTTTGCGACATTAAGCCAGAGCTCCATCACAACTTGACTCTTCAAAAGAAACTCCACGG, WBGene00060371
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region