WormMine: Gene WBGene00060512

• WormBase Gene ID: WBGene00060512
• Gene Name: Cre-pghm-1
• Sequence Name: CRE03921
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable copper ion binding activity and oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen. Predicted to be involved in peptide metabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans pghm-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03921.1	CRE03921.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03921	CRE03921		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101358
• Remark: CRE03921, CCTGGTGCACCAGATTACCGTTGGACTCGAGAAGCCGATTTGAATCATATTCCAAAATAA, WBGene00060512
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region