WormMine: Gene WBGene00060521

• WormBase Gene ID: WBGene00060521
• Gene Name: CRE03719
• Sequence Name: CRE03719
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ATP binding activity and galactokinase activity. Predicted to be involved in carbohydrate phosphorylation and galactose metabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans tag-96.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03719.1	CRE03719.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03719	CRE03719		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096816
• Remark: Cre-tag-96, TGGGGCATCTTATGAATGAAAGTCATCGAAGTTGTGCAATCGATTACGAGTGTAGTTGCA, WBGene00060521
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region