WormMine: Gene WBGene00060969

• WormBase Gene ID: WBGene00060969
• Gene Name: Cre-mig-1
• Sequence Name: CRE20801
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable Wnt receptor activity. Predicted to be involved in Wnt signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans mig-1. In C. elegans, mig-1 is involved in several processes, including mitochondrial unfolded protein response; neuron migration; and positive regulation of axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20801.1	CRE20801.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20801	CRE20801		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112773
• Remark: Cre-mig-1, TAAGCAAAGAAGGATATCAACCAGCCGTCCCAAAACTTCCCCAACCAGCGATCCCTGGAA, WBGene00060969
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region