WormMine: Gene WBGene00061173

• WormBase Gene ID: WBGene00061173
• Gene Name: Cre-cox-4
• Sequence Name: CRE14047
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in mitochondrial electron transport, cytochrome c to oxygen. Predicted to be part of mitochondrial respiratory chain complex IV. Is an ortholog of C. elegans cox-4. In C. elegans, cox-4 is involved in mitochondrial electron transport, cytochrome c to oxygen.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14047.1	CRE14047.1		[unknown]
Transcript:CRE14047.2	CRE14047.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14047	CRE14047		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093579
• Remark: CRE14047, TGCTCGAGAAGGGACAATTCTTGGGAGCCCCAACCAAATACGATTACGAGAACCAGAAAT, WBGene00061173
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region