WormMine: Gene WBGene00061842

• WormBase Gene ID: WBGene00061842
• Gene Name: Cre-dcr-1
• Sequence Name: CRE24509
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable organic cyclic compound binding activity and ribonuclease III activity. Predicted to be involved in RNA processing. Is an ortholog of C. elegans dcr-1. In C. elegans, dcr-1 is involved in several processes, including nucleobase-containing compound catabolic process; olfactory learning; and regulatory ncRNA-mediated gene silencing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24509.1	CRE24509.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24509	CRE24509		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102285
• Remark: Cre-dcr-1, ATCTGCTCTCGTCAATAACACCATTTTCGCGTCGTTAGCCGTGAAATTCGAGTTCCAAAA, WBGene00061842
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region