WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061857 Gene Name  Cre-cox-6A
Sequence Name  ? CRE24495 Organism  Caenorhabditis remanei
Automated Description  Predicted to be located in mitochondrial inner membrane. Predicted to be part of mitochondrial respiratory chain complex IV. Is an ortholog of C. elegans cox-6A. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE24495.1 CRE24495.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE24495 CRE24495   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-tag-174, AACAAGGCCGAGCAATTCGTGCCAGGAACCGGATTCGAGGCCGAACGCGAGAAGCACTAA, WBGene00061857   Expr1114447 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region