WormMine: Gene WBGene00062156

• WormBase Gene ID: WBGene00062156
• Gene Name: Cre-egl-8
• Sequence Name: CRE18480
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity and phosphatidylinositol phospholipase C activity. Predicted to be involved in intracellular signal transduction and lipid metabolic process. Is an ortholog of C. elegans egl-8. In C. elegans, egl-8 is involved in several processes, including G protein-coupled dopamine receptor signaling pathway; positive regulation of acetylcholine secretion, neurotransmission; and taxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE18480.1	CRE18480.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE18480	CRE18480		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111486
• Remark: Cre-egl-8, AGTAGAAGTTGGCAATTATAAAGAAGAACAATTGGCTGCCCAACCCACTTCTGTTGTCTG, WBGene00062156
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region