WormMine: Gene WBGene00062272

• WormBase Gene ID: WBGene00062272
• Gene Name: Cre-scp-1
• Sequence Name: CRE22566
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable sterol binding activity. Predicted to be involved in SREBP signaling pathway. Predicted to be located in Golgi membrane and endoplasmic reticulum membrane. Is an ortholog of C. elegans scp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE22566.1	CRE22566.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE22566	CRE22566		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112722
• Remark: Cre-scp-1, GCAGCGACCGCCTCGTCGGATTCGGTCACTTTTTGGGATTTGAAACATCGCGCCATTATT, WBGene00062272
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region