WormMine: Gene WBGene00062757

• WormBase Gene ID: WBGene00062757
• Gene Name: Cre-fat-2.2
• Sequence Name: CRE10277
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water. Predicted to be involved in lipid metabolic process. Is an ortholog of C. elegans fat-2. In C. elegans, fat-2 is involved in collagen and cuticulin-based cuticle development; fatty acid biosynthetic process; and innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10277.1	CRE10277.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10277	CRE10277		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093009
• Remark: CRE10277, AACCATCGACAGACATTGGGGATTCGGACTCGACAACATCATGCATAACATTACAAATGG, WBGene00062757
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region