WormMine: Gene WBGene00062788

• WormBase Gene ID: WBGene00062788
• Gene Name: Cre-dcap-2
• Sequence Name: CRE10095
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity; hydrolase activity; and manganese ion binding activity. Is an ortholog of C. elegans dcap-2. In C. elegans, dcap-2 is involved in several processes, including deadenylation-dependent decapping of nuclear-transcribed mRNA; determination of adult lifespan; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE10095.1	CRE10095.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE10095	CRE10095		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1094208
• Remark: Cre-dcap-2, GCATGTGGGAAGAGGGTTGGTACCGTGAGCAGCTTGCAGCTACTGCAGGAACAAGTATAT, WBGene00062788
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region