WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00062912 Gene Name  Cre-lsy-12
Sequence Name  ? CRE22791 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable histone acetyltransferase activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans lsy-12. In C. elegans, lsy-12 is involved in cell fate specification; maintenance of left/right asymmetry; and positive regulation of gene expression. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE22791.1 CRE22791.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE22791 CRE22791   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-lsy-12, CAGAGCACCTACAGTACACCGGAGCAGCAGACGCAGCAGTTCATGAGCCCTCAAATGGCG, WBGene00083272   Expr1115826 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-mys-3, TACGAACCAGATGTGAATAATCTGTCGTGTATAATGACACTTCCGTGTTATCAAGATCAG, WBGene00062912   Expr1114966 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE09490, GCCCACATCAAGCACCGGAGAAGGGAAAACCGAGAGGACGGAAACCGGGGAAAAAGAGGA, WBGene00083628   Expr1111175 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region