WormMine: Gene WBGene00062922

• WormBase Gene ID: WBGene00062922
• Gene Name: Cre-egl-47
• Sequence Name: CRE22848
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in sensory perception of taste. Predicted to be located in membrane. Is an ortholog of C. elegans egl-47. In C. elegans, egl-47 is involved in G protein-coupled receptor signaling pathway and egg-laying behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE22848.1	CRE22848.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE22848	CRE22848		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1101607
• Remark: Cre-egl-47, CAAGTGATTATGGCGGTTCTTCATATTCTGATTATTTGTTCGACAGGGATGATGACTAAT, WBGene00062922
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region