WormMine: Gene WBGene00062974

• WormBase Gene ID: WBGene00062974
• Gene Name: Cre-met-2
• Sequence Name: CRE01054
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity; histone methyltransferase activity; and zinc ion binding activity. Predicted to be located in nucleus. Is an ortholog of C. elegans met-2. In C. elegans, met-2 is involved in several processes, including negative regulation of vulval development; regulation of gene expression; and vulval cell fate commitment.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01054.1	CRE01054.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01054	CRE01054		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098448
• Remark: Cre-met-2, AACTGACATGGGATTACCAGTATACCGAACTTGATACAGAAAGTGCAAGACTCTCTTGCA, WBGene00062974
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region