WormMine: Gene WBGene00063220

• WormBase Gene ID: WBGene00063220
• Gene Name: CRE27641
• Sequence Name: CRE27641
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in stress response to metal ion. Is an ortholog of C. elegans F22H10.2; F53A9.1; and kreg-1. In C. elegans, F22H10.2 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE27641.1	CRE27641.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE27641	CRE27641		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1097703
• Remark: CRE27641, CTATTACGGAAACGGAGGATACAACCCATACGAGCAACAAGGTTTTGCTCCACCACCAAT, WBGene00063220
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region