WormMine: Gene WBGene00063639

• WormBase Gene ID: WBGene00063639
• Gene Name: CRE09046
• Sequence Name: CRE09046
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable chondroitin 4-sulfotransferase activity. Predicted to be involved in chondroitin sulfate biosynthetic process and positive regulation of response to oxidative stress. Predicted to be located in membrane. Is an ortholog of C. elegans F36D1.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE09046.1	CRE09046.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE09046	CRE09046		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110983
• Remark: CRE09046, CATCGAGTCGAAGCTGAACGACAAGTACGTGAAGACCCATTTATAAGAGATCTACTGCAC, WBGene00063639
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region