WormMine: Gene WBGene00063826

• WormBase Gene ID: WBGene00063826
• Gene Name: CRE25767
• Sequence Name: CRE25767
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable aminoacylase activity. Predicted to be involved in amino acid metabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans C10C5.3; C10C5.4; and C10C5.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25767.1	CRE25767.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25767	CRE25767		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098603
• Remark: CRE25767, GGTTTCACTCCAATGGTCAACACACCATTCCTTTTGCATGACAAGGATGAATGTTTGAAT, WBGene00063826
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region