WormMine: Gene WBGene00063929

• WormBase Gene ID: WBGene00063929
• Gene Name: Cre-rab-28.2
• Sequence Name: CRE14141
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans rab-28. In C. elegans, rab-28 is involved in several processes, including axoneme assembly; locomotory exploration behavior; and regulation of cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE14141.1	CRE14141.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE14141	CRE14141		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104214
• Remark: Cre-rab-28, TCCAGTCGACTCTCACAGAAACTTCTCGAATAGTAACAACATGATGCCAACCTATGTTTC, WBGene00063929
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region