WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00064061 Gene Name  Cre-amph-1
Sequence Name  ? CRE13487 Organism  Caenorhabditis remanei
Automated Description  Predicted to be located in cytoplasm. Is an ortholog of C. elegans amph-1. In C. elegans, amph-1 is involved in lipid tube assembly involved in organelle fission; nucleus localization; and nucleus organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13487.1 CRE13487.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13487 CRE13487   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-amph-1, CAAATTGTGATGCAATTGGACAAACTCGGTGAGTCAATGGACTATTTGAGAGTTGCTCGT, WBGene00064061   Expr1108389 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region