WormMine: Gene WBGene00064082

• WormBase Gene ID: WBGene00064082
• Gene Name: Cre-mab-5
• Sequence Name: CRE26605
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable DNA binding activity. Is an ortholog of C. elegans mab-5. In C. elegans, mab-5 is involved in several processes, including neuroblast migration; positive regulation of mesodermal cell fate specification; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE26605.1	CRE26605.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE26605	CRE26605		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095931
• Remark: Cre-mab-5, CATAAGTATTTGACACGAAAACGGAGACAAGAGATCTCGGAGACACTTCATTTGACTGAG, WBGene00064082
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region