WormMine: Gene WBGene00064143

• WormBase Gene ID: WBGene00064143
• Gene Name: Cre-taf-6.1
• Sequence Name: CRE17959
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA polymerase II general transcription initiation factor activity. Predicted to be involved in transcription initiation at RNA polymerase II promoter. Predicted to be part of SAGA complex; SLIK (SAGA-like) complex; and transcription factor TFIID complex. Is an ortholog of C. elegans taf-6.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17959.1	CRE17959.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17959	CRE17959		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096784
• Remark: Cre-taf-6.1, ATGCAAACAGCACATTGAGGCGGGCAATCGAATGCAAACGACGACGTCACAGTTGTCGAT, WBGene00064143
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region