WormMine: Gene WBGene00064192

• WormBase Gene ID: WBGene00064192
• Gene Name: Cre-nsun-1
• Sequence Name: CRE03509
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable RNA binding activity; RNA methyltransferase activity; and S-adenosylmethionine-dependent methyltransferase activity. Predicted to be involved in RNA methylation and RNA processing. Is an ortholog of C. elegans nsun-1. In C. elegans, nsun-1 is involved in several processes, including negative regulation of cellular response to heat; negative regulation of locomotion involved in locomotory behavior; and positive regulation of reproductive process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03509.1	CRE03509.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03509	CRE03509		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096262
• Remark: Cre-nol-1, CGTGCGGCAGCTAGAACCGGAGCGAAATCTGTCAAAAATCGACGAAAGAAGATGTTGGCG, WBGene00064192
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region