WormMine: Gene WBGene00064391

• WormBase Gene ID: WBGene00064391
• Gene Name: Cre-unc-112
• Sequence Name: CRE04985
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in integrin-mediated signaling pathway. Is an ortholog of C. elegans unc-112. In C. elegans, unc-112 is involved in several processes, including muscle cell cellular homeostasis; positive regulation of supramolecular fiber organization; and regulation of engulfment of apoptotic cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04985.1	CRE04985.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04985	CRE04985		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110466
• Remark: Cre-unc-112, GAATTCATTATTTCATTGTGAGATTCCGCAACGCTAGAAAAGCTGAGCTGGTGGCTGTTG, WBGene00064391
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region