WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00056971 Gene Name  CRE08941
Sequence Name  ? CRE08941 Organism  Caenorhabditis remanei
Automated Description  Predicted to be a structural constituent of cuticle. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE08941.1 CRE08941.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE08941 CRE08941   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE
  Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:membranous_oraganelle_CRE

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE08941, GAGGATCTGGAAATAGAGGAGTATGTCCAAAATATTGCGCGATTGATGGAGGAGTCTTCT, WBGene00056971   Expr1108553 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region