WormMine: Gene WBGene00064516

• WormBase Gene ID: WBGene00064516
• Gene Name: CRE06828
• Sequence Name: CRE06828
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable calcium ion binding activity and phospholipase A2 activity. Predicted to be involved in arachidonic acid secretion; lipid catabolic process; and phospholipid metabolic process. Predicted to be located in extracellular region. Is an ortholog of C. elegans F44B9.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE06828.1	CRE06828.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE06828	CRE06828		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102382
• Remark: CRE06828, GAATGTGACAATCAATTCTGCGCATGCCTCGCCACAATAATCTCCAATCCGTTCTGCCAG, WBGene00064516
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region